ID: 1120555991_1120555993

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1120555991 1120555993
Species Human (GRCh38) Human (GRCh38)
Location 14:85930427-85930449 14:85930444-85930466
Sequence CCAGTAACAGGCCAAGAGCTGCT GCTGCTTGCTGTCTCTCAAAAGG
Strand - +
Off-target summary {0: 1, 1: 20, 2: 198, 3: 226, 4: 284} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!