ID: 1120649969_1120649974

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1120649969 1120649974
Species Human (GRCh38) Human (GRCh38)
Location 14:87120177-87120199 14:87120230-87120252
Sequence CCAATTCATGAATCATTCTTTGC GAGTAGGCTCAGGAGTGGAGAGG
Strand - +
Off-target summary {0: 18, 1: 68, 2: 152, 3: 253, 4: 501} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!