ID: 1120731591_1120731598

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1120731591 1120731598
Species Human (GRCh38) Human (GRCh38)
Location 14:88008917-88008939 14:88008938-88008960
Sequence CCTAGTTTCCAAGTGAGGACCCC CCACAGGCCACAACTACTTAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 15, 4: 177} {0: 1, 1: 0, 2: 0, 3: 11, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!