ID: 1120759662_1120759667

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1120759662 1120759667
Species Human (GRCh38) Human (GRCh38)
Location 14:88274133-88274155 14:88274155-88274177
Sequence CCGCCATGGTTCTTTCCCTGGCC CTCCAATGTCCCGTGTGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 278} {0: 1, 1: 0, 2: 1, 3: 11, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!