ID: 1120778626_1120778634

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1120778626 1120778634
Species Human (GRCh38) Human (GRCh38)
Location 14:88464978-88465000 14:88465006-88465028
Sequence CCACACTCTCCTCCCTCCTCCTC TCTGGCTAGACATTGCTTTCTGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 62, 3: 676, 4: 4636} {0: 1, 1: 0, 2: 1, 3: 7, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!