ID: 1120778627_1120778635

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1120778627 1120778635
Species Human (GRCh38) Human (GRCh38)
Location 14:88464987-88465009 14:88465018-88465040
Sequence CCTCCCTCCTCCTCCTGTTTCTG TTGCTTTCTGGACGTTTCTAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 22, 3: 231, 4: 1772} {0: 1, 1: 0, 2: 0, 3: 15, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!