|
Left Crispr |
Right Crispr |
| Crispr ID |
1120789290 |
1120789301 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:88564010-88564032
|
14:88564059-88564081
|
| Sequence |
CCCAGGCTGGTCTTAACTCCTGG |
TCCCTAGGTGCTGGGAGTGCGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 19, 1: 199, 2: 441, 3: 709, 4: 2300} |
{0: 1, 1: 3, 2: 181, 3: 12121, 4: 333085} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|