ID: 1120789294_1120789301

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1120789294 1120789301
Species Human (GRCh38) Human (GRCh38)
Location 14:88564028-88564050 14:88564059-88564081
Sequence CCTGGGCTCAAGCAATTATCTGA TCCCTAGGTGCTGGGAGTGCGGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 305, 3: 4904, 4: 27041} {0: 1, 1: 3, 2: 181, 3: 12121, 4: 333085}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!