|
Left Crispr |
Right Crispr |
| Crispr ID |
1120799690 |
1120799693 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:88674810-88674832
|
14:88674839-88674861
|
| Sequence |
CCTAGATACAATGGGGGTACAGG |
ATAATACAGCTGTCCCAAATAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 735, 1: 1597, 2: 1800, 3: 1346, 4: 982} |
{0: 1, 1: 0, 2: 13, 3: 160, 4: 473} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|