ID: 1120806068_1120806077

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1120806068 1120806077
Species Human (GRCh38) Human (GRCh38)
Location 14:88752581-88752603 14:88752622-88752644
Sequence CCAGAAAGTCATCTCTTACTAAT AATACTGGGTAGAAGAAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 193} {0: 2, 1: 7, 2: 23, 3: 75, 4: 371}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!