ID: 1120813345_1120813349

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1120813345 1120813349
Species Human (GRCh38) Human (GRCh38)
Location 14:88826897-88826919 14:88826930-88826952
Sequence CCTTCTTGGAGATTCAGGATGCA TCTGAGTAGTTTTGAAGAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 45, 4: 255} {0: 1, 1: 0, 2: 1, 3: 34, 4: 371}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!