ID: 1120813730_1120813737

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1120813730 1120813737
Species Human (GRCh38) Human (GRCh38)
Location 14:88831303-88831325 14:88831329-88831351
Sequence CCCTAATTTGCATTGGCCCACCC AATTTGCATGTAATTGAAAGTGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 8, 3: 27, 4: 89} {0: 22, 1: 98, 2: 205, 3: 271, 4: 495}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!