|
Left Crispr |
Right Crispr |
| Crispr ID |
1120813730 |
1120813738 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:88831303-88831325
|
14:88831330-88831352
|
| Sequence |
CCCTAATTTGCATTGGCCCACCC |
ATTTGCATGTAATTGAAAGTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 4, 2: 8, 3: 27, 4: 89} |
{0: 26, 1: 115, 2: 189, 3: 287, 4: 465} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|