ID: 1120844145_1120844156

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1120844145 1120844156
Species Human (GRCh38) Human (GRCh38)
Location 14:89111729-89111751 14:89111755-89111777
Sequence CCCGCACTCGGAACAGCCGGCCG CTGCCGGCCCCGGGCAATGAGGG
Strand - +
Off-target summary No data {0: 136, 1: 318, 2: 344, 3: 293, 4: 423}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!