ID: 1120847590_1120847595

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1120847590 1120847595
Species Human (GRCh38) Human (GRCh38)
Location 14:89139584-89139606 14:89139608-89139630
Sequence CCTGCAGGTGAGAGAGAGCCTGG ACCTGTGTGGAGAGCTTCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 50, 4: 427} {0: 1, 1: 0, 2: 1, 3: 17, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!