ID: 1120852234_1120852237

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1120852234 1120852237
Species Human (GRCh38) Human (GRCh38)
Location 14:89181689-89181711 14:89181711-89181733
Sequence CCAGCCTGATTTTGTCTGAGGGT TTACCTAAGAGGAGAACCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 142} {0: 1, 1: 0, 2: 0, 3: 15, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!