ID: 1120862456_1120862460

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1120862456 1120862460
Species Human (GRCh38) Human (GRCh38)
Location 14:89267067-89267089 14:89267080-89267102
Sequence CCTTCTTCCCTTCTTCCCTACAG TTCCCTACAGGAAAAAAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 122, 4: 1189} {0: 1, 1: 0, 2: 5, 3: 19, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!