ID: 1120864595_1120864602

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1120864595 1120864602
Species Human (GRCh38) Human (GRCh38)
Location 14:89284961-89284983 14:89284984-89285006
Sequence CCCAAGGGGATATCCTGAGTCAA CAGGTCGGACAGCCTGAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 118} {0: 1, 1: 0, 2: 1, 3: 19, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!