ID: 1120887560_1120887570

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1120887560 1120887570
Species Human (GRCh38) Human (GRCh38)
Location 14:89463702-89463724 14:89463744-89463766
Sequence CCATAAGTTACTAGGGCTCCCCC CTGGGGAATCAGAGATATGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 44} {0: 1, 1: 0, 2: 1, 3: 5, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!