ID: 1120930734_1120930739

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1120930734 1120930739
Species Human (GRCh38) Human (GRCh38)
Location 14:89845733-89845755 14:89845761-89845783
Sequence CCCAAAGGACACTGTGATTCTGT AGGGAGAAGCAGGCTGAAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 277} {0: 1, 1: 0, 2: 6, 3: 73, 4: 803}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!