ID: 1120942093_1120942096

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1120942093 1120942096
Species Human (GRCh38) Human (GRCh38)
Location 14:89958350-89958372 14:89958363-89958385
Sequence CCAAGAATAATGAGGTTAGGCTG GGTTAGGCTGACAACCGAAGGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 37, 3: 109, 4: 321} {0: 1, 1: 0, 2: 0, 3: 5, 4: 45}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!