ID: 1120969858_1120969864

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1120969858 1120969864
Species Human (GRCh38) Human (GRCh38)
Location 14:90198245-90198267 14:90198296-90198318
Sequence CCCACATAATAGGAGGCCTCCAG TATTGAGACCTACTATGCGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 15, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!