ID: 1120996537_1120996548

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1120996537 1120996548
Species Human (GRCh38) Human (GRCh38)
Location 14:90422255-90422277 14:90422306-90422328
Sequence CCCTTGAGCGAAGACAGAATATT GCAAACACAGTGTCTGAGCACGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 17, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!