ID: 1121013361_1121013369

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1121013361 1121013369
Species Human (GRCh38) Human (GRCh38)
Location 14:90534551-90534573 14:90534572-90534594
Sequence CCTCACTGGGCAATGCCCACCCT CTGTCGGCCTTGAGAGGTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 211} {0: 1, 1: 0, 2: 0, 3: 8, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!