ID: 1121019162_1121019173

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1121019162 1121019173
Species Human (GRCh38) Human (GRCh38)
Location 14:90568578-90568600 14:90568613-90568635
Sequence CCCTGGGCCCATGAAGCTTCTGG AGTCCTCGGTGAGGACAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 208} {0: 1, 1: 0, 2: 1, 3: 21, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!