ID: 1121050155_1121050163

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1121050155 1121050163
Species Human (GRCh38) Human (GRCh38)
Location 14:90815190-90815212 14:90815215-90815237
Sequence CCCTCTGCCCTCTGGCCACGGTG CTGGTGCCTGCGCTTTAGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 339} {0: 1, 1: 0, 2: 0, 3: 7, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!