ID: 1121055523_1121055527

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1121055523 1121055527
Species Human (GRCh38) Human (GRCh38)
Location 14:90848942-90848964 14:90848988-90849010
Sequence CCTCATTAAGCCAGGCAGAGGAT AGTCCACCGCACTCCAGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 147} {0: 1, 1: 84, 2: 4441, 3: 91457, 4: 277132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!