ID: 1121096183_1121096193

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1121096183 1121096193
Species Human (GRCh38) Human (GRCh38)
Location 14:91219669-91219691 14:91219691-91219713
Sequence CCCTGCCCACTCTGGCCCTTGGC CCCAGGGGCACCTTAAAGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 71, 4: 488} {0: 1, 1: 0, 2: 1, 3: 13, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!