ID: 1121105059_1121105070

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1121105059 1121105070
Species Human (GRCh38) Human (GRCh38)
Location 14:91274143-91274165 14:91274186-91274208
Sequence CCTTCACTGCCACTCAGACCTCT AGAGAGAGGCAGAATGGGGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 33, 4: 380} {0: 1, 1: 1, 2: 19, 3: 208, 4: 1598}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!