ID: 1121105707_1121105715

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1121105707 1121105715
Species Human (GRCh38) Human (GRCh38)
Location 14:91278126-91278148 14:91278167-91278189
Sequence CCGGGGCAAAGTGGCCAGGTCCC CGCTGCTGAAGCTCTCAGACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 60, 4: 755} {0: 1, 1: 0, 2: 0, 3: 8, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!