ID: 1121106310_1121106318

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1121106310 1121106318
Species Human (GRCh38) Human (GRCh38)
Location 14:91282118-91282140 14:91282142-91282164
Sequence CCTGGGTCCCCTCCAAAATGACA CAGGGTCTCCATTTTGGAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 195} {0: 1, 1: 0, 2: 7, 3: 75, 4: 481}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!