ID: 1121107219_1121107229

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1121107219 1121107229
Species Human (GRCh38) Human (GRCh38)
Location 14:91289040-91289062 14:91289072-91289094
Sequence CCGGTGCGGGACCCTTCAGGACA TCACCCGACCACGGCCAGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 96} {0: 1, 1: 0, 2: 1, 3: 7, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!