ID: 1121108607_1121108618

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1121108607 1121108618
Species Human (GRCh38) Human (GRCh38)
Location 14:91296771-91296793 14:91296814-91296836
Sequence CCCTGCCAGACCTGCCTCACCAG GTTAAGATCTCATCTGGAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 329} {0: 1, 1: 0, 2: 1, 3: 12, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!