ID: 1121109255_1121109260

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1121109255 1121109260
Species Human (GRCh38) Human (GRCh38)
Location 14:91301377-91301399 14:91301412-91301434
Sequence CCAGACTCCACCTGCCAAAACCT TGCACATTAAGAATACAATAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 314} {0: 1, 1: 0, 2: 2, 3: 19, 4: 350}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!