ID: 1121112384_1121112388

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1121112384 1121112388
Species Human (GRCh38) Human (GRCh38)
Location 14:91321169-91321191 14:91321188-91321210
Sequence CCGCTCTCCTCCAACACCAGGGA GGGACGCGTCCCGCAGCCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 437} {0: 1, 1: 0, 2: 1, 3: 15, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!