ID: 1121114430_1121114433

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1121114430 1121114433
Species Human (GRCh38) Human (GRCh38)
Location 14:91333712-91333734 14:91333732-91333754
Sequence CCTGTAAAATGCAGATTTCTAGG AGGGCCTGCCCTTACTCCCTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 26, 4: 205} {0: 1, 1: 0, 2: 2, 3: 21, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!