ID: 1121121253_1121121258

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1121121253 1121121258
Species Human (GRCh38) Human (GRCh38)
Location 14:91377129-91377151 14:91377145-91377167
Sequence CCCACCTCAGACTGCCTGCCCTG TGCCCTGAGCTTTTCTCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 33, 4: 422} {0: 1, 1: 0, 2: 2, 3: 29, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!