ID: 1121137802_1121137806

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1121137802 1121137806
Species Human (GRCh38) Human (GRCh38)
Location 14:91513972-91513994 14:91514013-91514035
Sequence CCCAGGCTGGAGTGCAGTAGCAC CCTCTGTCTCCCCAGGTTCAAGG
Strand - +
Off-target summary {0: 1535, 1: 57576, 2: 157039, 3: 215405, 4: 181973} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!