ID: 1121148813_1121148816

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1121148813 1121148816
Species Human (GRCh38) Human (GRCh38)
Location 14:91611251-91611273 14:91611264-91611286
Sequence CCAGGAAGAAATATATTCCAATC TATTCCAATCTAATTGGTTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 229} {0: 1, 1: 0, 2: 0, 3: 13, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!