ID: 1121155239_1121155246

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1121155239 1121155246
Species Human (GRCh38) Human (GRCh38)
Location 14:91677102-91677124 14:91677135-91677157
Sequence CCCAAAGCCATAAAAATCCTGGA GGCAATACCATTCAGGACATAGG
Strand - +
Off-target summary {0: 1, 1: 44, 2: 1145, 3: 14779, 4: 8254} {0: 8681, 1: 11646, 2: 4690, 3: 2246, 4: 1617}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!