|
Left Crispr |
Right Crispr |
Crispr ID |
1121155239 |
1121155247 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
14:91677102-91677124
|
14:91677140-91677162
|
Sequence |
CCCAAAGCCATAAAAATCCTGGA |
TACCATTCAGGACATAGGCATGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 44, 2: 1145, 3: 14779, 4: 8254} |
{0: 13524, 1: 7516, 2: 2647, 3: 1163, 4: 728} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|