ID: 1121160315_1121160321

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1121160315 1121160321
Species Human (GRCh38) Human (GRCh38)
Location 14:91732783-91732805 14:91732802-91732824
Sequence CCTGCTTTACCCTCATATCCTGA CTGAAATATGTCTGGTATCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 174} {0: 1, 1: 0, 2: 3, 3: 16, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!