ID: 1121160451_1121160454

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1121160451 1121160454
Species Human (GRCh38) Human (GRCh38)
Location 14:91734425-91734447 14:91734472-91734494
Sequence CCAGCCTTCTTATCCTTTTTATG GTTCAAAGACTAAGATAACGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 3, 3: 46, 4: 688} {0: 1, 1: 0, 2: 1, 3: 4, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!