|
Left Crispr |
Right Crispr |
| Crispr ID |
1121167662 |
1121167665 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:91822755-91822777
|
14:91822788-91822810
|
| Sequence |
CCCAGGCTGGAGTGCAGTGGCGT |
CACTGTAAGCTCTGTCTTCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 20980, 1: 129116, 2: 240855, 3: 208608, 4: 116024} |
{0: 1, 1: 15, 2: 724, 3: 11996, 4: 72796} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|