ID: 1121168813_1121168826

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1121168813 1121168826
Species Human (GRCh38) Human (GRCh38)
Location 14:91836292-91836314 14:91836324-91836346
Sequence CCGGGTCCCGCCGCCCTCCTCCG GTCCCACGCCCGCGCTGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 437} {0: 1, 1: 0, 2: 0, 3: 13, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!