ID: 1121170953_1121170957

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1121170953 1121170957
Species Human (GRCh38) Human (GRCh38)
Location 14:91854260-91854282 14:91854279-91854301
Sequence CCCTGGGCTTGATTTTCCTTATT TATTTCCTATAGAAACTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 58, 4: 465} {0: 1, 1: 0, 2: 1, 3: 20, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!