ID: 1121235946_1121235957

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1121235946 1121235957
Species Human (GRCh38) Human (GRCh38)
Location 14:92391344-92391366 14:92391363-92391385
Sequence CCCAGCCCAACCCTTGTGCCAAC CAACCCCAGGGTCTCCAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 149} {0: 1, 1: 0, 2: 3, 3: 34, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!