ID: 1121244807_1121244816

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1121244807 1121244816
Species Human (GRCh38) Human (GRCh38)
Location 14:92454011-92454033 14:92454048-92454070
Sequence CCAATAAGTTTGGACCCAGGACC CAGCAGGATCATCATTAATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 63} {0: 1, 1: 0, 2: 0, 3: 8, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!