ID: 1121247294_1121247306

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1121247294 1121247306
Species Human (GRCh38) Human (GRCh38)
Location 14:92471232-92471254 14:92471277-92471299
Sequence CCACTGGCCTCTGCAACTCCAGT CAAGGAGGACAAAGGGCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 32, 4: 410} {0: 1, 1: 0, 2: 4, 3: 52, 4: 665}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!