|
Left Crispr |
Right Crispr |
| Crispr ID |
1121254555 |
1121254564 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:92521608-92521630
|
14:92521631-92521653
|
| Sequence |
CCCTTCCCCTTCCACCATGATTG |
GAGGCTTCCTGAGCCTCACCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 41, 1: 1283, 2: 3172, 3: 5238, 4: 6574} |
{0: 1, 1: 0, 2: 5, 3: 19, 4: 234} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|